DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_010162 |
| Line Availability | available from NASC (N510162) and ABRC (SALK_010162) |
| Confirmed for Hit | At4g36610 |
| Parent of DUPLO pair | 7905 |
| Parent of pair(s) | none |
Gene hit At4g36610
| Sequence (A. th genome BLAST matches underlined) | GAACTGCCACGTCACGATTCCTTCGCCAGCGAAACCATGGATTAACAAGACGACAGGCTT TTTAGGTTTATCGGGTTTCGTTGGTTTTCCGGTACCGGAATT |
| GenBank Accession | ED610833 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr4:17267038 - go to primer design |
| BLAST e Value | 1e-51 |
| Hit Clone Code (BAC ID) | AP22 |
| Hit Gene Code | At4g36610 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | alpha/beta-Hydrolases superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |




gabi-kat.de 