DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_017266c
Line Availability available from NASC (N665395) and ABRC (SALK_017266c)
Parent of DUPLO pair 12273
Parent of pair(s) none

Gene hit At2g35200

 
Sequence (A. th genome BLAST matches underlined)
AACCTCTGTACAATGGAGATCTTTGTTGAAAAATCATCTTGGAGACTCTTGATTGTCTGA
AAACCTTAATCGGACTTGGAAAGTACCAACCATTTCCCTTACTAGTCACCGGCGTCGGTG
AGAATAGAACTTCTCCGGCAACGGAATT
GenBank Accession ED576826 [GenBank]
Graphic View Graphic view of gene At2g35200
Predicted Position of Insertion Chr2:14834491 - go to primer design
BLAST e Value 5e-79
Hit Clone Code (BAC ID) T4C15
Hit Gene Code At2g35200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DUF740 family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37