DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_018180c
Line Availability available from NASC (N665408) and ABRC (SALK_018180c)
Parent of DUPLO pair 12126
Parent of pair(s) none

Gene hit At5g66450

 
Sequence (A. th genome BLAST matches underlined) 
TTTGGGGTATAAGACGTGGTTAAGGGTTTCTCAGAAGCT
GenBank Accession ED577471 [GenBank]
Graphic View Graphic view of gene At5g66450
Predicted Position of Insertion Chr5:26535712 - go to primer design
BLAST e Value 6e-10
Hit Clone Code (BAC ID) K1F13
Hit Gene Code At5g66450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phosphatidic acid phosphatase (PAP2) family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37