DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_024893c
Line Availability available from NASC (N661887) and ABRC (SALK_024893c)
Parent of DUPLO pair none
Parent of pair(s) 4123, 9916, 9939

Gene hit At2g17480

 
Sequence (A. th genome BLAST matches underlined) 
TTCATTGCAGCGTTACAAAACCACACCACATTCGATGAGATACGAAGGACTTGACTCTGA
AACTNCTGANCTCGACACAGATAATGAAGCT
GenBank Accession BZ661422 [GenBank]
Graphic View Graphic view of gene At2g17480
Predicted Position of Insertion Chr2:7590808 - go to primer design
BLAST e Value 2e-34
Hit Clone Code (BAC ID) F5J6
Hit Gene Code At2g17480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Seven transmembrane MLO family protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37