DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_036325c |
| Line Availability | available from NASC (N670547) and ABRC (SALK_036325c) |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 1622, 8454, 8460, 97383 |
Gene hit At4g25260
| Sequence (A. th genome BLAST matches underlined) | CGGCAAGCGCGGTCTCAGCAAGCT |
| GenBank Accession | ED583315 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:12936385 - go to primer design |
| BLAST e Value | 4e-06 |
| Hit Clone Code (BAC ID) | F24A6 |
| Hit Gene Code | At4g25260 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Plant invertase/pectin methylesterase inhibitor superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | unknown |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 