DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_036325c |
Line Availability | available from NASC (N670547) and ABRC (SALK_036325c) |
Parent of DUPLO pair | none |
Parent of pair(s) | 1622, 8454, 8460, 97383 |
Gene hit At4g25260
Sequence (A. th genome BLAST matches underlined) | CGGCAAGCGCGGTCTCAGCAAGCT |
GenBank Accession | ED583315 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr4:12936385 - go to primer design |
BLAST e Value | 4e-06 |
Hit Clone Code (BAC ID) | F24A6 |
Hit Gene Code | At4g25260 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | Plant invertase/pectin methylesterase inhibitor superfamily protein |
Insertion Classification | CDSi |
Confirmation Status | unknown |
Last Updated on Thursday, 10 June 2021 13:37 |