DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_036960
Line Availability available from NASC (N536960) and ABRC (SALK_036960)
Parent of DUPLO pair 12166
Parent of pair(s) none

Gene hit At1g47578

 
Sequence (A. th genome BLAST matches underlined) 
CCTCTCTCTTTATTTTCTCTTTCAGGCAATTTTAACGAACCCGTTACGTGCCTTCTTCAA
CAATGCATAACAGAGTATACATTTTTACAGGTGTGAGTGTTTTGATCTCTACGATCAATT
A
GenBank Accession ED584947 [GenBank]
Graphic View Graphic view of gene At1g47578
Predicted Position of Insertion Chr1:17484510 - go to primer design
BLAST e Value 5e-51
Hit Clone Code (BAC ID) F16N3
Hit Gene Code At1g47578 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Biotin/lipoate A/B protein ligase family
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37