DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_043897
Line Availability available from NASC (N543897) and ABRC (SALK_043897)
Parent of DUPLO pair none
Parent of pair(s) 221, 4010, 4292, 11216

Gene hit At1g77020

 
Sequence (A. th genome BLAST matches underlined) 
TTACTTGGGAGCTGAGAATTTTCCAGTCCGAGCATACGCTTCACGATGAACCGGATCACT
TAGAACCTGGTAAGCT
GenBank Accession BH746546 [GenBank]
Graphic View Graphic view of gene At1g77020
Predicted Position of Insertion Chr1:28946463 - go to primer design
BLAST e Value 1e-31
Hit Clone Code (BAC ID) F22K20
Hit Gene Code At1g77020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNAJ heat shock N-terminal domain-containing protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37