DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_044204
Line Availability available from NASC (N544204) and ABRC (SALK_044204)
Parent of DUPLO pair none
Parent of pair(s) 4927, 4963, 96088, 96091, 96094, 96097

Gene hit At2g04032

 
Sequence (A. th genome BLAST matches underlined) 
TTGCCAGAATTACACCCGAAGCTAAAGTCTTAACGATCACAGACATTTCTCGATCGGGTC
CTAAAGCAGGAATGGAACGAGAAAACAACGGTAAAGAAACACCGATCATGCTCGCCACTA
AGATAGATGGGATTGCAATGATTTTAAGCT
GenBank Accession BH754837 [GenBank]
Graphic View Graphic view of gene At2g04032
Predicted Position of Insertion Chr2:1290253 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) F3C11
Hit Gene Code At2g04032 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation zinc transporter 7 precursor
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit ED587447 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37