DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_047141
Line Availability available from NASC (N547141) and ABRC (SALK_047141)
Parent of DUPLO pair none
Parent of pair(s) 3642, 3742, 8281, 92989

Gene hit At4g10850

 
Sequence (A. th genome BLAST matches underlined) 
TGCAAACACCATAATTTTGAGTGTAATTGGTGGTGATGAAGAAGAATAAATTA
GenBank Accession BH908302 [GenBank]
Graphic View Graphic view of gene At4g10850
Predicted Position of Insertion Chr4:6675079 - go to primer design
BLAST e Value 2e-20
Hit Clone Code (BAC ID) F25I24
Hit Gene Code At4g10850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nodulin MtN3 family protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37