DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_059274
Line Availability available from NASC (N559274) and ABRC (SALK_059274)
Parent of DUPLO pair none
Parent of pair(s) 678, 3366

Gene hit At5g44560

 
Sequence (A. th genome BLAST matches underlined) 
AACCAGGTTCTTGATGAGATTGGTGTTGGTGTTGCATCTCAG
GenBank Accession CC179201 [GenBank]
Graphic View Graphic view of gene At5g44560
Predicted Position of Insertion Chr5:17947851 - go to primer design
BLAST e Value 2e-16
Hit Clone Code (BAC ID) MFC16
Hit Gene Code At5g44560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SNF7 family protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37