DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_070743c
Line Availability available from NASC (N666384) and ABRC (SALK_070743c)
Parent of DUPLO pair 12834
Parent of pair(s) none

Gene hit At1g69450

 
Sequence (A. th genome BLAST matches underlined) 
AATGTGTTTTTCGCAACTGTTTTCTCTGGATCAGCCTTCTACAAGCT
GenBank Accession BH850059 [GenBank]
Graphic View Graphic view of gene At1g69450
Predicted Position of Insertion Chr1:26108161 - go to primer design
BLAST e Value 2e-19
Hit Clone Code (BAC ID) F10D13
Hit Gene Code At1g69450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Early-responsive to dehydration stress protein (ERD4)
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37