DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_079963c
Line Availability available from NASC (N657695) and ABRC (SALK_079963c)
Parent of DUPLO pair none
Parent of pair(s) 4086, 4171, 7239, 83550, 83557, 83560, 83563

Gene hit At2g31360

 
Sequence (A. th genome BLAST matches underlined) 
GGAATGGTAAGTGAATGTCTCTATATATTTTTAAAACGTATAGTATTTTGGTCGATATAA
ATTGTAGAATCAATTAGCAATTA
GenBank Accession BH901541 [GenBank]
Graphic View Graphic view of gene At2g31360
Predicted Position of Insertion Chr2:13372714 - go to primer design
BLAST e Value 2e-40
Hit Clone Code (BAC ID) T28P16
Hit Gene Code At2g31360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 16:0delta9 desaturase 2
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37