DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_084650 |
Line Availability | available from NASC (N584650) and ABRC (SALK_084650) |
Parent of DUPLO pair | 12015 |
Parent of pair(s) | none |
Gene hit At1g55630
Sequence (A. th genome BLAST matches underlined) | GGGCTGAGCCGAGCTGGGAAGTTAGAAGCT |
GenBank Accession | BZ594657 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr1:20792245 - go to primer design |
BLAST e Value | 2e-09 |
Hit Clone Code (BAC ID) | F20N2 |
Hit Gene Code | At1g55630 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | Pentatricopeptide repeat (PPR) superfamily protein |
Insertion Classification | CDSi |
Confirmation Status | failed |
Last Updated on Thursday, 10 June 2021 13:37 |