DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_103614c
Line Availability available from NASC (N663530) and ABRC (SALK_103614c)
Parent of DUPLO pair none
Parent of pair(s) 3994, 4083, 4100, 4189

Gene hit At1g79860

 
Sequence (A. th genome BLAST matches underlined) 
GAAAAATGGTGGATTCCGACCGTCAAAGTTCCACCAGATGGTCTATCAGAAGCT
GenBank Accession BH903887 [GenBank]
Graphic View Graphic view of gene At1g79860
Predicted Position of Insertion Chr1:30043113 - go to primer design
BLAST e Value 2e-23
Hit Clone Code (BAC ID) F19K16
Hit Gene Code At1g79860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RHO guanyl-nucleotide exchange factor 12
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37