DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_113003
Line Availability available from NASC (N613003) and ABRC (SALK_113003)
Confirmed for Hit At1g15720
Parent of DUPLO pair 163
Parent of pair(s) none

Gene hit At1g15720

 
Sequence (A. th genome BLAST matches underlined) 
GGTTTACGCTTTTCCACTGTTATCGGCTCTGAAACCAGTAGATTCCGACGACTGTGTAAA
ACTCAAGCTAACTGCTGTTTTGCGGGATATCTCCAATTCCATGATTCAAGGTACCGTAGA
CGAAGGAATGCTTGATCTCCTCGAAATTCTTGAGAAGCTT
GenBank Accession BZ379202 [GenBank]
Graphic View Graphic view of gene At1g15720
Predicted Position of Insertion Chr1:5406197 - go to primer design
BLAST e Value 4e-86
Hit Clone Code (BAC ID) F7H2
Hit Gene Code At1g15720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TRF-like 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37