GABI-DUPLO confirmation strategy

 

The confirmation strategy resembles the one, which is used in GABI-Kat. After a DUPLO line is taken into process, a segregation is started and mixed DNA from 12-18 individual T2 plants is prepared for the confirmation. The FST-based prediction of the insertion site is confirmed by sequencing an amplicon from the respective locus spanning the fusion between plant genomic DNA and the T-DNA. The figure below gives an overview over the generation of confirmation sequences for left border FSTs of GABI-Kat lines. 

 

picture of confirmation process for GABI-Kat LB FSTs

 

The figure applies to the confirmation of FSTs in GABI-Kat lines, which were created at the left border (LB) with the primer o8409. In case of right border (RB) FSTs in GABI-Kat lines, o3144/35St is used instead of o8474 and o8409 in both the confirmation PCR and amplicon sequencing. The result obtained from sequencing the confirmation amplicon is compared to the FST prediction, and if the two sequences match the insertion allele is considered "confirmed", and the individual T2 plants can be genotyped.

The confirmation process for SALK lines resembles the process for GABI-Kat FSTs. The SALK collection is based only on LB FSTs. Therefore only one primer, LBb1-3 is needed for the confirmation PCR.

 

Primer nameSequence (5' to 3')
o3144/35St GTGGATTGATGTGATATCTCC
o8409 ATATTGACCATCATACTCATTGC
o8474 ATAATAACGCTGCGGACATCTACATTTT
LBb1-3 ATTTTGCCGATTTCGGAAC

 

The following temperature profile is used in the confirmation PCR:

 

94 °C

2 min


  

94 °C

30 sec

  
59 °C 30 sec 37 cycles
72 °C 90 sec  

 

72 °C

 

5 min

  
15 °C for ever  

 

As a control for the presence of the T-DNA in the genome of a genotyped plant, a PCR with T-DNA specific primers is done. The primer combination for GABI-Kat lines is Sul2/Sul4. Besides Sul2 and Sul4 there are additional Sul-specific primers available, which can be used. Further information can be found at the GABI-Kat vector and primer info page. The respective primer combination used for SALK lines is G171/G172.

 

Primer nameSequence (5' to 3')
Sul2 GTCGAACCTTCAAAAGCTGAAGT
Sul4 ATTTCACACAGGAAACAGCTATGA
G171 TCATTTCGAACCCCAGAGTC
G172 CGCATGATTGAACAAGATGG

 

Note 1: The gene specific primer is designed with a tm of 60 °C.
Note 2: Usually both sequences, the sequence generated with the gene specific primer and the one generated with the border primer give the same result. Nevertheless, if only one sequence matches to the FST, the insertion is regarded as confirmed.