DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_002536
Line Availability available from NASC (N502536) and ABRC (SALK_002536)
Confirmed for Hit At5g66940
Parent of DUPLO pair 12587
Parent of pair(s) none

Gene hit At5g66940

 
Sequence (A. th genome BLAST matches underlined) 
AGGTTGTGAGAAGTTGTAGTTGTTGTAGTAACAGAACTTGGTGTTGGTTGATTCACAGCG
AGGACAAGAAAGCTGCTCTTGTTGATCCGTCGGAATCGCAACAGATCCTCCTTGGCCGTG
GGGAATCTTAGGAACCCGACGAGATTCACTGAATT
GenBank Accession ED592524 [GenBank]
Graphic View Graphic view of gene At5g66940
Predicted Position of Insertion Chr5:26728502 - go to primer design
BLAST e Value 4e-83
Hit Clone Code (BAC ID) MUD21
Hit Gene Code At5g66940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Dof-type zinc finger DNA-binding family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37