DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_003186
Line Availability available from NASC (N503186) and ABRC (SALK_003186)
Confirmed for Hit At5g47140
Parent of DUPLO pair 11953
Parent of pair(s) none

Gene hit At5g47140

 
Sequence (A. th genome BLAST matches underlined) 
TTGGACGTCCCACACATGTCCTTCTCTTACAAGGAAAAGTCGAGTCCCACGCATTAGATT
GTGCACAGCTCTCGGAGTTTGATACAACCGATCCTGAACTCGATCTATTGCTAGCTTCTT
CATCCAGAGCCTTCCTCTTGAAACCGGTATGGAATT
GenBank Accession ED593043 [GenBank]
Graphic View Graphic view of gene At5g47140
Predicted Position of Insertion Chr5:19145906 - go to primer design
BLAST e Value 1e-83
Hit Clone Code (BAC ID) K14A3
Hit Gene Code At5g47140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GATA transcription factor 27
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit queueing for submission to ENA/GenBank


Last Updated on Thursday, 10 June 2021 13:37