DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_009404c
Line Availability available from NASC (N679300) and ABRC (SALK_009404c)
Confirmed for Hit At3g26910
Parent of DUPLO pair 2273
Parent of pair(s) none

Gene hit At3g26910

 
Sequence (A. th genome BLAST matches underlined) 
TAAAGGAGAGAGACATATTCCTCCTGAGTCTCGACCTGCTTACAGGGAGTTTCATGATGA
ATCCACTATGTGCATTTTTCGATTGAAATCGCTGAAAGAAGGACAAGCTCGTACTCTCCT
AATACAAGGAGTCCGACACCACACTGCTCACGTAAAG
GenBank Accession ED610216 [GenBank]
Graphic View Graphic view of gene At3g26910
Predicted Position of Insertion Chr3:9917254 - go to primer design
BLAST e Value 3e-65
Hit Clone Code (BAC ID) MDJ14
Hit Gene Code At3g26910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hydroxyproline-rich glycoprotein family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37