DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_017723
Line Availability available from NASC (N517723) and ABRC (SALK_017723)
Confirmed for Hit At5g11930
Parent of DUPLO pair 1861
Parent of pair(s) none

Gene hit At5g11930

 
Sequence (A. th genome BLAST matches underlined) 
GCCTCAACGAGCCTGTCGTTCGATGAAGAGGAAACATCAGAGTCAAAGATCGGACGGCTG
ATATCAGAGCATCCAGTCATCATATTCACTCGATTTTCCTCATGTTGCATGTGCCACGTC
ATGAAGAAGCT
GenBank Accession BH747483 [GenBank]
Graphic View Graphic view of gene At5g11930
Predicted Position of Insertion Chr5:3845488 - go to primer design
BLAST e Value 2e-66
Hit Clone Code (BAC ID) F14F18
Hit Gene Code At5g11930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Thioredoxin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH747483 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37