DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_021907
Line Availability available from NASC (N521907) and ABRC (SALK_021907)
Confirmed for Hit At2g36220
Parent of DUPLO pair 887
Parent of pair(s) none

Gene hit At2g36220

 
Sequence (A. th genome BLAST matches underlined) 
TTGACGGTGCATACAGTGGATACCTTCTCTTCTGGATCTCACTCTACCGAGGCACCACAC
TCTAGGAGAAGAAGGTTCCAGAAGCAAAATATCCGTCTTTATCCTTGACCCGACCCGTTT
AAAGATGACCCGGTTCTTGCCCGCGTG
GenBank Accession BZ288521 [GenBank]
Graphic View Graphic view of gene At2g36220
Predicted Position of Insertion Chr2:15193068 - go to primer design
BLAST e Value 9e-50
Hit Clone Code (BAC ID) F2H17
Hit Gene Code At2g36220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BZ288521 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37