DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_022152
Line Availability available from NASC (N522152) and ABRC (SALK_022152)
Confirmed for Hit At3g09680
Parent of DUPLO pair 11656
Parent of pair(s) none

Gene hit At3g09680

 
Sequence (A. th genome BLAST matches underlined) 
ATCTGATGAAATGTCCGGGGGTTCTCAATTTCTTTTATCTTCTATTTGAATATCTTCAGT
AAGACACGTGGTATGGGAGCTGGTCGCAAGCT
GenBank Accession BZ288762 [GenBank]
Graphic View Graphic view of gene At3g09680
Predicted Position of Insertion Chr3:2969854 - go to primer design
BLAST e Value 1e-38
Hit Clone Code (BAC ID) F11F8
Hit Gene Code At3g09680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein S12/S23 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37