DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_028863
Line Availability available from NASC (N528863) and ABRC (SALK_028863)
Confirmed for Hit At4g31080
Parent of DUPLO pair 12618
Parent of pair(s) none

Gene hit At4g31080

 
Sequence (A. th genome BLAST matches underlined) 
CTTCAAGTCGGCAAACATTGATCTCTCTTTCGTTGCATGGCTATGCCACGCCTACGAGAC
ATACTTAAGAAAACCACTTTATGTATTTCTATTGCTATATACAGGCATAGATGCATGTCT
CTGTTGGCATTAAATACAATGAATT
GenBank Accession BH753452 [GenBank]
Graphic View Graphic view of gene At4g31080
Predicted Position of Insertion Chr4:15122246 - go to primer design
BLAST e Value 3e-77
Hit Clone Code (BAC ID) F6E21
Hit Gene Code At4g31080 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation integral membrane metal-binding family protein (DUF2296)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37