DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_032878c
Line Availability available from NASC (N662038) and ABRC (SALK_032878c)
Confirmed for Hit At2g17650
Parent of DUPLO pair none
Parent of pair(s) 717, 70708, 70729, 70738, 70753, 70763, 70767, 70771, 70772, 70773

Gene hit At2g17650

 
Sequence (A. th genome BLAST matches underlined) 
AATTTTCTGCTCTGATTAGGGTTCTCGATTTAGGTTTAGTGATAAAAGAGG
GenBank Accession ED580036 [GenBank]
Graphic View Graphic view of gene At2g17650
Predicted Position of Insertion Chr2:7671401 - go to primer design
BLAST e Value 1e-21
Hit Clone Code (BAC ID) T19E12
Hit Gene Code At2g17650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AMP-dependent synthetase and ligase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37