DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_034924c
Line Availability available from NASC (N654133) and ABRC (SALK_034924c)
Confirmed for Hit At3g15540
Parent of DUPLO pair 6839
Parent of pair(s) none

Gene hit At3g15540

 
Sequence (A. th genome BLAST matches underlined) 
AACATAATTGTTACTAACCGATGCCACGGACACCGAAGAGCTTATCAAGAGCAAAGGCTA
GATCATCATAGCCTTGGCTCGAACCAAGATCCATCTTCCTCAAATAAGGCACACCATCCA
TGCTCACTTTCACATACCCTAACTCCACTTTCCTGGTCGAAGCT
GenBank Accession ED582440 [GenBank]
Graphic View Graphic view of gene At3g15540
Predicted Position of Insertion Chr3:5264526 - go to primer design
BLAST e Value 2e-81
Hit Clone Code (BAC ID) MJK13
Hit Gene Code At3g15540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation indole-3-acetic acid inducible 19
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37