DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_038787c
Line Availability available from NASC (N662161) and ABRC (SALK_038787c)
Confirmed for Hit At3g56370
Parent of DUPLO pair 2310
Parent of pair(s) none

Gene hit At3g56370

 
Sequence (A. th genome BLAST matches underlined) 
ACTGCGAGCTTGGTCGACGCGGATTTGTACCGCTGTGCAAAACCGTAATCCGACATGGGG
ATCCTGAAACTATCTAGAAGCTCACTGCCTCCAGGCTCGTCAAGCCTCCGGACCAATT
GenBank Accession ED583772 [GenBank]
Graphic View Graphic view of gene At3g56370
Predicted Position of Insertion Chr3:20900256 - go to primer design
BLAST e Value 3e-06
Hit Clone Code (BAC ID) T5P19
Hit Gene Code At3g56370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37