DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_038994c
Line Availability available from NASC (N674557) and ABRC (SALK_038994c)
Confirmed for Hit At1g08230
Parent of DUPLO pair 11846
Parent of pair(s) none

Gene hit At1g08230

 
Sequence (A. th genome BLAST matches underlined) 
ACATTGGTATGAGCTCAACTTTTGTTCGTGGTTGGTTAATATCACAATATATGTATTGTG
TAAACCTATGATTTTTAAAAAAATACTTTTCTATACTGTTTGGTCTTGTTTCGAATTATA
AGAAG
GenBank Accession ED583924 [GenBank]
Graphic View Graphic view of gene At1g08230
Predicted Position of Insertion Chr1:2585969 - go to primer design
BLAST e Value 8e-53
Hit Clone Code (BAC ID) T23G18
Hit Gene Code At1g08230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transmembrane amino acid transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37