DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_041461c
Line Availability available from NASC (N658204) and ABRC (SALK_041461c)
Confirmed for Hit At2g28725
Parent of DUPLO pair 11876
Parent of pair(s) none

Gene hit At1g28660

 
Sequence (A. th genome BLAST matches underlined) 
TGGTACAGTGGATACATAAAAGGAGCAGTTAGAATT
GenBank Accession BH750521 [GenBank]
Graphic View Graphic view of gene At1g28660
Predicted Position of Insertion Chr1:10071874 - go to primer design
BLAST e Value 6e-13
Hit Clone Code (BAC ID) F1K23
Hit Gene Code At1g28660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GDSL-like Lipase/Acylhydrolase superfamily protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At2g28725

 
Sequence (A. th genome BLAST matches underlined) 
ATGACCATAACTCCTGCGCAATATCGTTGGTAAAAAAACGTCTAAATATGAATT
GenBank Accession ED586535 [GenBank]
Graphic View Graphic view of gene At2g28725
Predicted Position of Insertion Chr2:12328870 - go to primer design
BLAST e Value 4e-06
Hit Clone Code (BAC ID) T11P11
Hit Gene Code At2g28725 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation forkhead box protein G1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37