DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_057821
Line Availability available from NASC (N557821) and ABRC (SALK_057821)
Confirmed for Hit At3g08950
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g08950

 
Sequence (A. th genome BLAST matches underlined) 
TTTTCCAGAAGCACGCTCGTTTTTATGATCTGAACCACCATCAGAACTCTCCGATCCTCC
AGATTTCTCATTTTTCTCCGAAGATTTTGTTTCCGGTTTACCTGAGTCATGTTTCGAGGT
AGTATCAGAAGCAGAAGTACTCAGCAAACATCTCTGATCCATTTTCAGCATTTCGATTCC
ACAGTTAAGTGAAAAAAACTGCAAAAGGAAGATAGCAATTAGAGAGCTCAAAACAAAGAG
AATTAGAAAATGAATT
GenBank Accession BH790752 [GenBank]
Graphic View Graphic view of gene At3g08950
Predicted Position of Insertion Chr3:2727721 - go to primer design
BLAST e Value 1e-130
Hit Clone Code (BAC ID) T16O11
Hit Gene Code At3g08950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation electron transport SCO1/SenC family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH790752 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37