DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_057856c
Line Availability available from NASC (N679722) and ABRC (SALK_057856c)
Confirmed for Hit At5g19310
Parent of DUPLO pair 2410
Parent of pair(s) none

Gene hit At5g19310

 
Sequence (A. th genome BLAST matches underlined) 
TCTCCTTCTCCGCCTCTTCGTGTAAGCTGTTTCTTCGATTTGCATGTTAGGATTTGTGGT
TGTGAATCGAATTTTCTGGCTCTGTGCTTCTTCAACTCCTTCTCTAACCAATTCCTTGGA
GTTTCCTTCTCGAATT
GenBank Accession BH790767 [GenBank]
Graphic View Graphic view of gene At5g19310
Predicted Position of Insertion Chr5:6499062 - go to primer design
BLAST e Value 7e-72
Hit Clone Code (BAC ID) F7K24
Hit Gene Code At5g19310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeotic protein regulator
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH790767 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37