DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_061038c |
Line Availability | available from NASC (N678567) and ABRC (SALK_061038c) |
Confirmed for Hit | At3g46620 |
Parent of DUPLO pair | 11865 |
Parent of pair(s) | none |
Gene hit At3g46620
Sequence (A. th genome BLAST matches underlined) | CCGGCAATCGACTTACACGGCGGAGGAGGAGGA |
GenBank Accession | ED591641 [GenBank] |
Graphic View | ![]() |
Predicted Position of Insertion | Chr3:17179706 - go to primer design |
BLAST e Value | 2e-06 |
Hit Clone Code (BAC ID) | F12A12 |
Hit Gene Code | At3g46620 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | zinc finger (C3HC4-type RING finger) family protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |