DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_061038c |
| Line Availability | available from NASC (N678567) and ABRC (SALK_061038c) |
| Confirmed for Hit | At3g46620 |
| Parent of DUPLO pair | 11865 |
| Parent of pair(s) | none |
Gene hit At3g46620
| Sequence (A. th genome BLAST matches underlined) | CCGGCAATCGACTTACACGGCGGAGGAGGAGGA |
| GenBank Accession | ED591641 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr3:17179706 - go to primer design |
| BLAST e Value | 2e-06 |
| Hit Clone Code (BAC ID) | F12A12 |
| Hit Gene Code | At3g46620 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | zinc finger (C3HC4-type RING finger) family protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 