DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_070257c
Line Availability available from NASC (N664677) and ABRC (SALK_070257c)
Confirmed for Hit At5g06000
Parent of DUPLO pair 1079
Parent of pair(s) none

Gene hit At5g06000

 
Sequence (A. th genome BLAST matches underlined) 
GAATTTGTCCACATTCAGAAAAGGCTACCAACAAGATACTTATATTGGTGACATACTGAC
CAATCACAGAAAGAAGCAGCCATATATGGCTAATATGTGATCGGCTAATTGGGCACCTTT
GTTATGTTACACAGTTAC
GenBank Accession BH849767 [GenBank]
Graphic View Graphic view of gene At5g06000
Predicted Position of Insertion Chr5:1808874 - go to primer design
BLAST e Value 5e-73
Hit Clone Code (BAC ID) K18J17
Hit Gene Code At5g06000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation eukaryotic translation initiation factor 3G2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37