DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_082254
Line Availability available from NASC (N582254) and ABRC (SALK_082254)
Confirmed for Hit At5g07240
Parent of DUPLO pair 2737
Parent of pair(s) none

Gene hit At5g07240

 
Sequence (A. th genome BLAST matches underlined) 
TTAGTGTATTACTTTGTGGTTTGAATTAAGTGTGTAACCAAGTTTTCTTTAATTCAGGCG
AGGAGGGCGTTGAGAGCACTGAAGGCATTAGTGAAGCT
GenBank Accession BZ352749 [GenBank]
Graphic View Graphic view of gene At5g07240
Predicted Position of Insertion Chr5:2273149 - go to primer design
BLAST e Value 2e-49
Hit Clone Code (BAC ID) T28J14
Hit Gene Code At5g07240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation IQ-domain 24
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37