DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_087610 |
| Line Availability | available from NASC (N587610) and ABRC (SALK_087610) |
| Confirmed for Hit | At5g15600 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 2712, 95165 |
Gene hit At5g15600
| Sequence (A. th genome BLAST matches underlined) | TGTTCCCAAACCAAAAAAGCCCAACCTTAAAACCGGTTTTA |
| GenBank Accession | ED597642 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr5:5078479 - go to primer design |
| BLAST e Value | 1e-08 |
| Hit Clone Code (BAC ID) | T20K14 |
| Hit Gene Code | At5g15600 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | SPIRAL1-like4 |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 