DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_095404c
Line Availability available from NASC (N671740) and ABRC (SALK_095404c)
Confirmed for Hit At3g25990
Parent of DUPLO pair 1231
Parent of pair(s) none

Gene hit At3g25990

 
Sequence (A. th genome BLAST matches underlined) 
TGATCTGGTGTGGCTGTAGATCTCCGTTTGATGTAACATCGCCGATCATCATGTTTATGT
CCCGTGAAGGATTGTTGTTATCGGAAACAAACATGTTTTCTCCAAGGAAGAAGGAGAGAT
AGCAGAAGATGTCAAAGATTAATATAAAAGGCGCGTGAGTCTTTAATTATTTGTCAAAGC
T
GenBank Accession ED600395 [GenBank]
Graphic View Graphic view of gene At3g25990
Predicted Position of Insertion Chr3:9506610 - go to primer design
BLAST e Value 1e-98
Hit Clone Code (BAC ID) MPE11
Hit Gene Code At3g25990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Homeodomain-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED600395 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37