DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_107550
Line Availability available from NASC (N607550) and ABRC (SALK_107550)
Confirmed for Hit At3g48850
Parent of DUPLO pair 2807
Parent of pair(s) none

Gene hit At3g48850

 
Sequence (A. th genome BLAST matches underlined) 
TGGAAATCTACTCGCCGGCGTATTTCGCGGCGTGTACAGACGCCGGGAGGCTGAGCTGCG
GTATCACCCACTCGGCGATTACGCCACTTGATGCCATCATATGCAACATGGCGGGGAAAG
TTCCAAACCAACTTCTCTATTTG
GenBank Accession BH905648 [GenBank]
Graphic View Graphic view of gene At3g48850
Predicted Position of Insertion Chr3:18116245 - go to primer design
BLAST e Value 9e-50
Hit Clone Code (BAC ID) T21J18
Hit Gene Code At3g48850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phosphate transporter 3;2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37