DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_117268
Line Availability available from NASC (N617268) and ABRC (SALK_117268)
Confirmed for Hit At4g37450
Parent of DUPLO pair 2587
Parent of pair(s) none

Gene hit At4g37450

 
Sequence (A. th genome BLAST matches underlined) 
GGCATTCTAAATATATTTATCATTTCACCTCTGATATTTTTTAGTTTTTATATTTTTGAC
CCTACCATTGTCTCTTTCTTTACGAATTTGGTAATGAGTATTATTTAATTGATTATACAG
TTTGTTTTCTTTTATTTTATTTATATGGAAATAATAAGAATT
GenBank Accession BZ381773 [GenBank]
Graphic View Graphic view of gene At4g37450
Predicted Position of Insertion Chr4:17605879 - go to primer design
BLAST e Value 3e-53
Hit Clone Code (BAC ID) F6G17
Hit Gene Code At4g37450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation arabinogalactan protein 18
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37