DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_129236c
Line Availability available from NASC (N663966) and ABRC (SALK_129236c)
Confirmed for Hit At1g05340
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g05340

 
Sequence (A. th genome BLAST matches underlined) 
AGCAACACTTGGCCGCAAGACTACCAGCCAAGATTCCATTAAAGAAAACCAGTCATATAT
ATCACAATTAGAACAAGAACTAACCTACCTGGGCTAAATATATCCGCCCATTAAGCATCA
CTTATGTGTGAATTAT
GenBank Accession BZ765181 [GenBank]
Graphic View Graphic view of gene At1g05340
Predicted Position of Insertion Chr1:1559105 - go to primer design
BLAST e Value 7e-29
Hit Clone Code (BAC ID) YUP8H12
Hit Gene Code At1g05340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cysteine-rich TM module stress tolerance protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37