DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_129340c
Line Availability available from NASC (N682919) and ABRC (SALK_129340c)
Confirmed for Hit At3g02070
Parent of DUPLO pair 2570
Parent of pair(s) none

Gene hit At3g02070

 
Sequence (A. th genome BLAST matches underlined) 
CTTCACATATTCCTGAGAGGCCATGTAACTTAACCACATACAGACTAGGACTAGTGCTTA
TGAGAAATANCCAGTAATTTTCCTTTCTTTTCTAACAAAATTTCCTTTGCATCTCCCTTT
GTGCAGGTTGCAGCAAAGATATGCTTGCTGACATCCTTTAGAGACACTTGTTTCCTTGAA
ATTATACCTCAATACCAAGCACCTAAGGGGGGTGAGACTACAAAAAAAAAATTTCCTTTC
CCTTTCGCATATCGCTTTTT
GenBank Accession BZ356564 [GenBank]
Graphic View Graphic view of gene At3g02070
Predicted Position of Insertion Chr3:362620 - go to primer design
BLAST e Value 1e-111
Hit Clone Code (BAC ID) F1C9
Hit Gene Code At3g02070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cysteine proteinases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37