DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_138998c
Line Availability available from NASC (N655998) and ABRC (SALK_138998c)
Confirmed for Hit At3g22180
Parent of DUPLO pair 12125
Parent of pair(s) none

Gene hit At3g22180

 
Sequence (A. th genome BLAST matches underlined) 
TTGTTCCTTATCTCTATACTTGCAGCCACATTTGCATCTGAGCTTACACTACTGATGATA
CTACCTGTGCCAATGGAACTAAGATCATTATCAGGTAAATGGCGATTATCTATCGGTCTT
ACGACAGAAGATGACGCTCTGGCTCTGGCAGCTGCCCTTGCAGCTTCATTTGGATCCAAC
TTTGCAAGCT
GenBank Accession BZ767533 [GenBank]
Graphic View Graphic view of gene At3g22180
Predicted Position of Insertion Chr3:7829784 - go to primer design
BLAST e Value 5e-92
Hit Clone Code (BAC ID) MKA23
Hit Gene Code At3g22180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DHHC-type zinc finger family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37