DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_009112
Line Availability available from NASC (N509112) and ABRC (SALK_009112)
Confirmed for Hit At1g44224
Parent of DUPLO pair 11975
Parent of pair(s) none

Gene hit At1g44224

 
Sequence (A. th genome BLAST matches underlined) 
CTCTCTCCCCATTTCGACCGCCGGATTACCCCAGAAACCGTGGCCTAAGCCGTCAGAATT
AGTGGCAGGCCGCCACCACGGCAAAGGCTATAGCCGCCTTGGAGACTCCAAGATTGGTTG
GGGTACCTCTTCCCTATCAGACTCTAAAGCACCTCTATCGCCCCCCGTATTGCTACCGGG
GTTTCCTAGCATCCCATGGCTTCCTAACATCCCAGGAATT
GenBank Accession ED609980 [GenBank]
Graphic View Graphic view of gene At1g44224
Predicted Position of Insertion Chr1:16821703 - go to primer design
BLAST e Value 1e-105
Hit Clone Code (BAC ID) T18F15
Hit Gene Code At1g44224 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ECA1 gametogenesis related family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37