DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_011535c
Line Availability available from NASC (N660708) and ABRC (SALK_011535c)
Confirmed for Hit At5g09760
Parent of DUPLO pair 2557
Parent of pair(s) none

Gene hit At5g09760

 
Sequence (A. th genome BLAST matches underlined) 
ACCGCCCAATCAAAAATCAAGTCTATTGTAGACTCGTCCGTAGGGAATCTAAACCGTACA
AACGCCGCGAACACGTGTCTCCAGCTTCTCACTTACTCCGAGCACCGCACTCAATCGACG
GATCAAGCT
GenBank Accession ED572220 [GenBank]
Graphic View Graphic view of gene At5g09760
Predicted Position of Insertion Chr5:3032716 - go to primer design
BLAST e Value 1e-67
Hit Clone Code (BAC ID) F17I14
Hit Gene Code At5g09760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant invertase/pectin methylesterase inhibitor superfamily
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit queueing for submission to ENA/GenBank


Last Updated on Thursday, 10 June 2021 13:37