DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_015230
Line Availability available from NASC (N515230) and ABRC (SALK_015230)
Confirmed for Hit At5g60550
Parent of DUPLO pair 2361
Parent of pair(s) none

Gene hit At5g60550

 
Sequence (A. th genome BLAST matches underlined)
GCCGATCTCCCGGGACTCCTGTCTTCACTGCTCCAGAATGTTGTTTAGGTCAGTTTCCTT
TCTAATTTCTCTAAGCT
GenBank Accession ED575252 [GenBank]
Graphic View Graphic view of gene At5g60550
Predicted Position of Insertion Chr5:24341661 - go to primer design
BLAST e Value 6e-37
Hit Clone Code (BAC ID) MUF9
Hit Gene Code At5g60550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation geminivirus rep interacting kinase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37