DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_016021c
Line Availability available from NASC (N667846) and ABRC (SALK_016021c)
Confirmed for Hit At3g42950
Parent of DUPLO pair 2569
Parent of pair(s) none

Gene hit At3g42950

 
Sequence (A. th genome BLAST matches underlined) 
GAAACAAAACCTGAAGAGCAGAGAATCTCAGCGTTCTCAGAGAGGAAAAGAGTCATATAA
CTAATGAGATTAAACGGAGCAGTGAGCCAACGACCAGGAGGAACATTAAGTTGACCACCT
CCTTTCTTAGCAAGCT
GenBank Accession ED575790 [GenBank]
Graphic View Graphic view of gene At3g42950
Predicted Position of Insertion Chr3:15015797 - go to primer design
BLAST e Value 1e-64
Hit Clone Code (BAC ID) F18P9
Hit Gene Code At3g42950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pectin lyase-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37