DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_018034
Line Availability available from NASC (N518034) and ABRC (SALK_018034)
Confirmed for Hit At5g59470
Parent of DUPLO pair 12244
Parent of pair(s) none

Gene hit At5g59470

 
Sequence (A. th genome BLAST matches underlined) 
GGATCNNTCTTACCANCAAACACAGTTGGTGCTATACCAAAATAAAGAATTGCTTTGACC
CAAGTTGTTACAGAGAGAGGTTGTGAGAAATAGTAGATACAAGCCACCAAGATTAAAGCT
GenBank Accession ED577347 [GenBank]
Graphic View Graphic view of gene At5g59470
Predicted Position of Insertion Chr5:23979113 - go to primer design
BLAST e Value 1e-54
Hit Clone Code (BAC ID) F2O15
Hit Gene Code At5g59470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mannose-P-dolichol utilization defect 1 protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37