DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_018378c
Line Availability available from NASC (N658537) and ABRC (SALK_018378c)
Confirmed for Hit At5g45620
Parent of DUPLO pair 12191
Parent of pair(s) none

Gene hit At5g45620

 
Sequence (A. th genome BLAST matches underlined)
GAGGTACAATTGCCTAGAGAAAAGTTTACCTGAAGATGATCTCGATAAGGCAGAGAATGT
TGATCTTTTCCAAAAGCT
GenBank Accession BH758290 [GenBank]
Graphic View Graphic view of gene At5g45620
Predicted Position of Insertion Chr5:18503180 - go to primer design
BLAST e Value 1e-37
Hit Clone Code (BAC ID) K2N11
Hit Gene Code At5g45620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Proteasome component (PCI) domain protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37