DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_020960c
Line Availability available from NASC (N659328) and ABRC (SALK_020960c)
Confirmed for Hit At4g18640
Parent of DUPLO pair 2594
Parent of pair(s) none

Gene hit At4g18640

 
Sequence (A. th genome BLAST matches underlined)
GTGAGCTACTCGAGGAGACAAGTAATTTAGCGGCTGAGCCTGCTCCTTCAGCTCCTAGTC
CTTCTCCCGGGATTATAACTGAAGCT
GenBank Accession BZ287582 [GenBank]
Graphic View Graphic view of gene At4g18640
Predicted Position of Insertion Chr4:10261734 - go to primer design
BLAST e Value 3e-42
Hit Clone Code (BAC ID) F28A21
Hit Gene Code At4g18640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37