DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_024490c
Line Availability available from NASC (N661868) and ABRC (SALK_024490c)
Confirmed for Hit At1g68440
Parent of DUPLO pair none
Parent of pair(s) 521

Gene hit At1g68440

 
Sequence (A. th genome BLAST matches underlined)
GAGGAAACCGTACAGGATCAAGACACATCGGAATCGCTATCGGAATCATCAAAAAGAGTT
GGAGAGGAAACAGAGACATCTATTTTTCTTAACCTAACAACTAGACTGTTGAGTTTACTA
ACAAAGTTGGTGAAATAAGCTAGAAATGCGATAATCAAAGCTCCCCATTTCCAAAAACCA
TAAGCTT
GenBank Accession BZ661028 [GenBank]
Graphic View Graphic view of gene At1g68440
Predicted Position of Insertion Chr1:25658416 - go to primer design
BLAST e Value 8e-88
Hit Clone Code (BAC ID) T2E12
Hit Gene Code At1g68440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37