DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_025426c |
Line Availability | available from NASC (N672384) and ABRC (SALK_025426c) |
Confirmed for Hit | At2g40290 |
Parent of DUPLO pair | 7898 |
Parent of pair(s) | none |
Gene hit At2g40290
Sequence (A. th genome BLAST matches underlined) | CTCACAGCTCTAGCCCCCTCCTTAACGACAAGCT |
GenBank Accession | BZ661946 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr2:16829318 - go to primer design |
BLAST e Value | 8e-12 |
Hit Clone Code (BAC ID) | T7M7 |
Hit Gene Code | At2g40290 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | Eukaryotic translation initiation factor 2 subunit 1 |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |