DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_040526c
Line Availability available from NASC (N670604) and ABRC (SALK_040526c)
Confirmed for Hit At2g35765
Parent of DUPLO pair 12379
Parent of pair(s) none

Gene hit At2g35765

 
Sequence (A. th genome BLAST matches underlined) 
GTTGGTCTCTGCCGAGGAAACACCAACCATCGGACAGAGGATACACTCATCCGCAGCCGA
CTTTACCAAATTCTTCTCATGAACATGCCCGCCCTGTCCTGGACTCCGCCCCCTCTACCG
CCAAATCCGCCTCCCACTGGTTTGGTGATAAAGCTAGATATGTTGTTTTAAATCTTTCTC
CTAGTTTCTA
GenBank Accession BH746379 [GenBank]
Graphic View Graphic view of gene At2g35765
Predicted Position of Insertion Chr2:15033684 - go to primer design
BLAST e Value 9e-66
Hit Clone Code (BAC ID) T20F21
Hit Gene Code At2g35765 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED585960 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37